TALK STORY

The Sereni-Tree, the Immortals, the Octagonal Order, and the Harbinger of Darkness

POSTED BY: THEREALME
UPDATED: Saturday, November 11, 2006 05:48
SHORT URL:
VIEWED: 19652
PAGE 1 of 4

Wednesday, September 20, 2006 4:44 PM

THEREALME



This is Thread 52 of the adventures of the Sereni-Tree!

For “The Guide to the Clubhouse / Treehouse / Sereni-Tree Threads”, telling our story and providing links to all such threads:
http://www.fireflyfans.net/thread.asp?b=11&t=11877


Early in this next link is the very long post containing “TheRealMe’s Guide to the Sereni-Tree, V6”. This post is a description of the ship and crew, the latter of which is out of date.
http://fireflyfans.net/thread.asp?b=11&t=20521


The latest, updated crew list is early in this thread:
http://fireflyfans.net/thread.asp?b=11&t=22611


Following is a summary of our previous thread, located at:
http://fireflyfans.net/thread.asp?b=11&t=23106

The Sereni-Tree has come to the planet Zanzibar, which was colonized long ago by SCA enthusiasts, fantasy role-players, and new age mystics in an attempt to live with only a Renaissance Faire level of technology – with magic! (Huzzah for the Zanzibarbarians!). They breeded some giant, firebreathing space chickens to use as mounts instead of horses. For some reason, the Sereni-Tree crew had been curious about these creatures and wanted to get one.

It seems that a small group of evil, bickering, Immortal magicians, each wearing a different color, has taken over the planet. They use magic to warp and change life and souls. Their latest project is something really, really, REALLY bad. These Immortals are opposed by the heroic Knights of the Octagon, who have a secret hidden magically warded castle carved out of a mountain. The full details on this history can be had on this thread, posted around September 12, 2006. Here one of the Knights of the Octagon, old Sir Devan, reveals these secrets to Wisp, including the Prophesy of the Dark Harbinger, which may include mention of our Sereni-Tree folk.

There is some subversive Alliance activity on this planet, and these agents are seen as techno-heretics. The Octagon looks upon them as tenuous allies since they also oppose the reign of the Immortals.

Meanwhile, the Sereni-Tree is in orbit under the temporary command of SimonWho. SimonWho has been asked by all the Brides to help them resurrect the late Bride1, who had been reaverized and slain long ago in a previous thread. Also, SimonWho’s Blue Box appeared in the Sereni-Tree common room and PsychicRiver stepped out, apparently having completed his visit to his own elsewhen.

So, what has happened on Zanzibar? Let’s see, Our Heroes climbed aboard the shuttle Admiral Nelson, departed the Sereni-Tree, and secretly landed on this planet. This crew included Cozen (with chaps and sniper rifle), Jadehand, Jake7 (who has the power to confuse chickens), LightMeDark (who has the power to speak to all animals), Mai (with a new tracking device in a necklace), Seryn, ScorpionRegent, his robot Snarky (playing appropriate music), TheRealMe, Wisp, XanderLHarris/Ash, and a bunch of robotic space chickens crafted by TheRealMe for use as mounts. Meanwhile, Seryn has made us period costumes though some (like Jake7’s) require slight modification due to modesty issues.

ScorpionRegent ended up in the dungeons of the local Baroness for crimes that he apparently committed the last time he was here, mostly thefts and crimes of the heart. Seryn also found her way to the castle, and bargained for his release. The Baroness wants them to fetch some item for her that she claims was stolen by another noble. SR thinks it might be some magical device of great power. A mercenary loyal to the Baroness is the half-human, half-chicken called “13” apparently created by an Immortal’s experiments. The robot Snarky’s whereabouts are unknown at this time, but it was last seen in the company of SR before his capture.

Wisp chased a monk armed with a machine gun and then encountered one of the Immortals, Alatariel the Lurker. Just before she was about to turn him into something unpleasant, he was rescued by Sir Devan of the Octagonal Order and taken to the Order’s hidden fortress. Devan relates a prophesy of something really bad coming, but also of a cryptic way to defeat it involving a magical key and a magical weapon of some unknown sort. Wisp has been given access to what technology the Octagonal Order has managed to acquire.

The rest of Our Heroes were in a local village inn, enjoying breakfast, when a young fellow, Sir Kei (apparently a Knight of the Octagon), was set upon by giant snakes of the Immortal Ouroborous the Infinite, all the while being watched by a magical silver eye of a third Immortal, Arinda the Empress. TheRealMe was briefly entangled by a giant snake, but was saved by Jadehand. After defeating the last of the snakes, Sir Kei invites Our Heroes to speak with him.

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Wednesday, September 20, 2006 4:47 PM

THEREALME


In the Throne Room of the Empress:

Alatariel strode into the great throne room, radiating false confidence. She was dressed in her finest gown of black velvet, a modest amount of silver jewelry dangling from her ears and from around her neck, her hair meticulously groomed by a host of her slave demons. She attempted to still the quivering in the depths of her soul. After all, what had she to fear? What harm could one Immortal truly deal to another?

She gulped, and put a pleasant smile upon her face. Arinda was a mentalist of the highest order. She had no need to harm one’s body. She could toy with one’s mind as she pleased, until it was something else entirely, even until nothing but the body remained!

The ceiling of the throne room seemed impossibly high. Illumination came from everywhere, and nowhere, to light her path. Great columns lined the way, interspersed with larger-than-life statues, all of one person, all of Arinda in her royal finery.

Upon a raised dias at the far end of the chamber was a massive throne made of gold, silver, and ivory, and littered with precious stones. In the throne a familiar figure sat regally, her arms resting comfortably at her side, her back straight, her head held level and motionless. She was dressed in a long, flowing lavender gown and cape of deepest violet, lined with ermine. A golden crown set with diamonds and amethysts rested upon her head, her long, dark hair carefully arranged to flow out from it and down over her shoulders like a cascade of a waterfall, framing her severe face. Her own eyes were closed, but all around her head floated the small silvery orbs that gave vision to her now. It was Arinda the Empress, Arinda of the Silver Eyes, Arinda the Violet.

When she reached the base of the dias, Alatariel bowed deeply, kneeled, and gazed upward. “Your Majesty, as I was summoned, I am here! Alatariel the Black is your faithful servant!”

“Damn!” Arinda muttered.

Alatariel began to tremble. “M-Majesty?”

Several of the silver eyes orbiting about Arinda’s head turned and focused upon Alatariel. But the Empress was clearly viewing some sight from a different location.

“That half-wit Kei! He called me a man again! And in front of newcomers! There will be all manner of confusion, now! I ask you, do I look like a man to you?”

A bead of sweat worked its way down the side of Alatariel’s face as her mind raced. The Empress had great power in Truthseeing. “Surely, Your Majesty, feminine beauty of your kind has rarely been seen in this world! I assure you, were you to enter a crowded room, I am certain that you would cause every head to turn!”

There! That was all true! Of course, Alatariel neglected to specify which DIRECTION the heads would turn.

“Yes, yes, you are so right, Ally. Still, that Kei!”

Seeing an opportunity to discredit her rival, Alatariel carefully ventured, “Kei? That young Knight of the Octagon? Wasn’t his capture part of the mission of Ouroborous and his snakes? Has Ouroborous… failed?”

“Yes,” Arinda snapped. “Just as part of YOUR mission was the capture of that techno-heretic! We can’t have these… these… ideas… spread among the commoners!”

“Yes, Majesty, of course. Unfortunately…”

“Unfortunately, you failed! Just as you have failed in other matters!”

Alatariel gulped again. “It is true, Your Majesty, that one of my hand-crafted chimeras escaped from the special lab…”

All of the silvery orbs snapped into focus upon Alatariel. Arinda’s face, eyes still closed, slowly turned toward her. “One escaped? What does it know? Is it dangerous?”

Alatariel silently cursed Ouroborous. He had not betrayed this embarrassing secret! He merely tricked her into revealing the secret herself! And to the Empress, no less! “Indeed, so, Majesty, but I deem it of little consequence. A semi-sentient at best. Please, put it out of your mind. If this is not the reason that I was summoned, then if it please Your Majesty, perhaps...”

“The Special Project. It is late.”

Alatariel nodded. “True, but we’re back on track now. To blend together the vital essences of so many fundamentally different creatures was a particularly difficult task. Demon, Troll, Human, Dragon…”

Arinda suddenly seemed curious. “He was a man? I mean, he was a dragon-man?”

A smile spread across Alatariel’s face. “Er, maybe he was just a dragon!”

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Wednesday, September 20, 2006 6:18 PM

JADEHAND



NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 3:33 AM

WASHSYOUNGERSEXIERBR

Inter Arma Enim Silent Leges


Wisp walked down the rows of debris viewing the corpses above him and the technology by his side. He wasnt paying much attention to the ships and such only the dead men swaying in the ceiling. The ropes and stains on the floor told him that theyd been fastened there as living traitors although now their skeletons only spoke of the punishment not their crime.

"can you take them down??" Wisp asked with a samaratins tear in his eye.

"I wish i could but the law dictates that they must hang for a century. I am sorry. I can have them moved to another room though."

"Thankyou I would be greatful" Wisp turned away from Sir Devan and returned his gaze to the men. The knight exited the room then returned a second later accompanied by two hobgoblin like creatures that clambered up the walls and dragged the bodies to a far corner of the room. Behind them came a ragtag bunch of people. A wizard, a blacksmith, an alchemist of some sorts and three very large burly chaps with strangley monsterish features.

"These are your team. If you require any more men dont hesitate to ask" Sir Devan bowed slightly and existed the room.

Wisp looked around the room now for the first time. There were several pieces of alliance hover tanks and troop transports some in better shapes than others. There were too alliance dropships but they were badly damaged and their engines were definatley unsalvagable. In the corner was a Behemoth tank in relativley good shape that would make a good starting point.

Wisp had three plans for the technology.
The first was an invetigation into the scientfic properties of magic and ways to defend against it.
The Second was a collection of small tanks ond the behemoth to combat the immortals.
The third was for Wisp alone, He had come up with the idea as soon as he had seen the A.I.E in the corner. An Armoured Infantry Exoskelton.


www.myspace.com/didxl
sexier.younger.brother@hotmail.co.uk

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 3:47 AM

SCORPIONREGENT


Quote:
Seryn pauses, right in the middle of their, ahem, activities, as a faint tingle pushes all the other thought out of her head.

"Um, SR? You know when you get that faint... no, make that strong, sense of forboding? Like the poop is about to hit it big time?"

"mmmrf?"

"I really think that it would be a great time to run around with a great big sign saying something like 'Whatever you are about to do DON'T DO IT!!!!!!!'"

*SR gives her a stern look, really really not caring two hoots either way*

"Oh never mind then... but I reserve the right to act like a big smug know-it-all when whoever is about to do something very stupid eventually does it"

*earns herself another (slightly strained) look from SR, and drops the subject, but is already practising the 'I told you so' dance.*






SR found himself in a terrible emotional dilemma, his entire being is focussed on Seryn and seeing to her "pleasure" and then she began to speak and suddenly he had to focus on her words. He didn't want to hear it, but it was his committed duty to listen. Her message was interesting, she had a point, though it seemed to be all intuition and speculation. He was about to do the dumb guy thing and dismiss her idea completely out of hand and yet he began to feel tingling sensation up his spine that screamed 'DANGER!!!!!!!!!' In on smooth action he spun Seryn around like a top and laid her flat upon the bed behind him, fell forward into a tumble, snatching up his cutlass and springing to his feet in front of the room's only door with his sword drawn.
The door burst open with great force and in strode a figure dressed all in armor to the sound of Aaron Copland's Fanfare for the Common Man.

"Snarky your timing leaves something to be desired, but you sure know how to make a entrance."



OOC: Seryn, I am hurt that you would think me unreceptive.

Sorry, I posted this last night on the previous thread. I must have been tired.

Scorpion Regent

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 11:54 AM

SERYN


ooc - It's not that i think you unreceptive deary (no less than i would be in the same situation!) its just it wasn't that important, I simply needed to warn Simonwho and all about the 'I told you so'chorus that I will be unable to stop myself from singing when the S*** hitteth the fan.

Ah well.

IC -

*pulls her dress back into place, but leaves her hair delightfully mussed.*

"Snarky! Who fixed you? Last time i saw you you were kinda laying on one side and twitching."

Snarky turns to reply, but she can't hear anything over the extremely loud music.

*Ducks under SR's arm*

"Does he always need a soundtrack?"




http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 12:31 PM

13


OoC: Trogdor the Burninator is the Project!? We're doomed....

IC:

Indeed, 13 had come into the world during troubled times.

It was bad enough that he'd lost his brethren to that black-robed woman, even worse that he'd been employed by a rather ruthless Baroness. Although neither of those could compare to being dismissed by one.

"You're firing me? After all of my dedication and reasonable fees?"

The Baroness sighed with unsheathed contempt, affixing her gaze on 13's beady, bewildered eyes.

"13, you simply don't have the edge, the qualities that we look for in our staff. You're unnecessarily polite, you're too kind to our prisoners, you have a very taxing diet..."

Cow.

"But I've served you long and well!"

She arched her eye. "Three months is long now?"

"It is when you're a professional soldier!" 13 blustered.

"And there is that. Your resume is hardly impressive. You call yourself a soldier, yet you have fought in no wars, never served anyone other than myself, and did nothing to stop that peculiar minstrel that arrived a short while ago. There is also the unsettling fact that I cannot find any proof of your existence prior to four months ago.

"Not to mention the smell."

Bitch.

13's fingers tightened on the grip of his longsword, knuckles whitening.

"Now go. You are, as of now, effectively dismissed."

* * * * * * * * * * * * *

13 clawed nervously at the roaddust, scraping his talons against the dirt. He had never been fired before, and he wasn't quite sure where to find another job. He could always try to find that black-robed person, who would lead him to his brothers and sisters....

A strange smell interrupted the cross-breeds thoughts. A scent of darkness, hunger, and dead things well into rot...and, strangely, Dr. Pepper.

13 turned in the direction of the odd smell, and nearly screamed.

Four great beasts lurked before him, massive canines with bodies of shadow itself. The breath of the hounds stank of corpses and Dr. Pepper. They had no defined shape, instead twisting and warping, black flames curling from them. The air grew cold as the approached 13, and an orb of night seemed to generate around the creatures, blotting out the sun.

13 unsheathed his iron longsword and readied his shield, flicking the blade back and forth in what he hoped was a menacing pattern. A dry, rattling sound, like wind rushing through bones, echoed through the summoned night, and it was only several moments later 13 realized the monsters were laughing at him.

Two leapt at him, mouths opening impossibly wide, (likely due to their indefinite physical shape) gnashing at the birdman. 13 dropped to the ground, evading the monsters leaping attacks, simultaneously thrusting his sword into one of the thing's underbellies, having no effect.

As 13 leapt to his feet, he saw that he had been encircled by the four demonic hounds, each one rearing back to leap, jaws yawning open.

A gleaming, silver arrow pierced into the darkness, trailing daylight from its feathers, stabbing through a hound's head. The creature let out an unearthly howl, then dissipated in a burst of black and gray smoke.

Three more arrows lunged forward, each one hitting its mark. The shadow hounds were destroyed in a whirlwind of screams, and their darkness was lifted.

A black-haired, leather-armored knight came into view, gleaming shortbow slung across his back, leather quiver at his hip, and plucked each silver shaft from the earth. An octagon was sewn into the quiver.

"Name's Wil," he said. "Sir Wil, as it were. And you're 13."

"Actually, I'm only about sev-" 13's face brightened. "Oh, you mean my name."

"Yes," the archer said readily, as if talking to a child. "I think you oughta come with me."


NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 12:52 PM

SERYN


ooc - that Baroness is such a cow, remind me to bitchslap her at some point.



http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 2:09 PM

SAFEAT2ND


Sir Kei’s eye widen with glee. “Ooooo chicken pot pie…. You really must come back for the evening meal! The chicken pot pie is exceptional!”

“Oh, I know not why Her Majesty dislikes me so.” Sir Kei answers with a shrug.

”Her Majesty? I thought you said His majesty earlier.” Jadehand asks puzzled.

“Were you to but lay eyes upon her countenance, you too would be pressed to tell the difference. She has never been accused of being a fair maiden.” Sir Kei says.

“I would suspect her dislike of me stems from my besting her Champion in a joust. To be fair to him, he did have a handicap.” Sir Kei shakes his head sadly. “It is hard to joust with ones opponents’ lance protruding from ones midsection. That was my good lance too.”


__________________________________________________
"Stop doing that thing"
"What thing"
"That thing where your mouth moves and noise comes out"

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 3:28 PM

THEREALME


Alatariel the Lurker returned to her special lab after a grueling interview with the Empress. She kept herself busy analyzing her thoughts, looking for opinions or ideas that were obviously too correct, memories that were abnormally crystal-clear and vivid.

Those would have been the ones most recently implanted.

A half-chicken chimera brought the dark sorceress back to awareness as it bowed deeply and greeted Alatariel at the secret entrance. It clung tightly to the umbrella that was its badge of status. “Mistress! There is a problem!”

“Hello, Number Two,” Alatariel sighed. “What now?”

“It would be easiest to show you, Mistress, but there is another rebel.”

“ANOTHER ONE? Take me to it!”

The pair walked down a maze of twisty windy passages, all alike, until they arrived at a certain door. Number Two opened it. Beyond was a prison, containing a dozen cells with bars of strong iron.

Number Two was uneasy. “He just quit working on his assigned task. He said that he resigns, but he won’t tell us why.”

Alatariel considered the imprisoned half-chicken for a short time. “Very well, Number Six, what do you have to say for yourself?”

“I am not a number! I am a free man!”

The sorceress scoffed. “You are clearly not a man. At best, you are half a man and half a chicken. As to your freedom… Heh.” She ran her fingers up and down one of the stout iron bars. “Well, I think not!”

The imprisoned half-chicken crossed his arms and stared back defiantly.

Alatariel mused a bit, mild concern showing in her face. “Hmmm… This is all rather inconvenient. I thought I could trust the even-numbered ones. I can only guess that I miscalculated somewhere on your formula. Perhaps there was the potential for some kind of creeping madness that I missed. Oh well, I suppose that I just have to scrap the lot of you and begin again.” Alatariel turned to leave the prison. “Perhaps I’ll cross humans with turkeys next. Or perhaps penguins! Yes, then they would be excellent swimmers…”

Number Two gulped as it watched Alatariel leave, then it slowly looked back at the prisoner.

Number Six smiled, and slowly drew his finger across his throat. “It is about time for a new Number Two, don’t you think?”

Number Two shivered, hugged its umbrella, and departed the prison.

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 21, 2006 9:49 PM

SERYN


Snuggled where she is, with SR muse, Seryn clips Snarky round the head.

The music finally stops, and she does a very good impression of someone one who's fingers aren't nearly broken now.

"Ok, now that we are up, i'm sorry to say this, but i think we need to find the others and see whats happening. They all went to the pub to get drunk, so gods only know whats happening now.

*kisses SR* we can carry on with this later?"

she grins and starts to pull on her coat (a very pretty fur lined thing she finds in the cupboard)(ooc- ain't making up wardrobes fun?) And starts to comb and pin up her hair.

"Now if you remember what clothes are, you might want to put some on, its chilly out there"


NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 3:43 AM

SCORPIONREGENT


Quote:

Originally posted by seryn:

"Now if you remember what clothes are, you might want to put some on, its chilly out there"








"But what if I need to do some deep thinking? Besides the Baroness is expecting us to stick around. Very well, you take Snarky to town and find our friends you'll probably be safer with them anyways. The last thing either of us wants is for her to keep you and your potential progeny as hostages to enforce her will upon me. I'll stay here and find out about the McGuffin she wants to retreived. If she gets all paranoind and sends out soldiers to find you make for a enclave of free amazons, they will shelter you and I will send word of my situation through their network. The Knights of the Octagonal Order are honorable, but they have their own agenda so if you wind up with them you could become a pawn in their game of life. You had best take this."
SR pulls Seryn to him and gives her a powerful kiss of romantic intensity +3 with the combined force multiplier of the fact that he he is still sans clothes. Snarky chooses this moment to play some ditty from the movie Princess Bride.

Scorpion Regent

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 12:43 PM

SERYN


*places back of hand against forhead*

"wow, that intense mix of gamer geek-speak and movie soundtracks really took my breath away.


Ok, you stay here if you really must, and i think you're being a tad over dramatic. No one is going to kidnapp me, no one should know about spawn, so i'll be fine. You one the other hand have Baroness Bitchy to contend with, so Snarky stays with you, to cover your ass.

Though i think he'd prefer it if you got some pants to do that, spare him the job.

I'm going to head down to the village, follow the smell of beer to their location and remain irritatingly cryptic about your whereabouts, then i'll be back.

*pulls hood up, kisses him breathless, just to show him how its done, and heads for the door*

'sides, I think he's running low on good music now, i don't want him around when he starts playing the Grease sountrack. I love you, i'll see you soon.

But fer heaven sakes put some frickin pants on!"

http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 1:57 PM

SIMONWHO


Hmm.

GTGCTAGCTAGCATGCATCGATGCATGCGCTAGCATCGATCGTATATCGATGCATGCAT
ATCGATCTAGCTAGCTAGTTCGATGCATCGTAGCTAGCTAGCACATGCTAGCTAGCTAG
GCTAGCTAGTACGATGCTAGCTGATCGATGCTAGCTAGTCGGCGCGGCTATATCGATCA
GCTAGCTAGTCAGTCGATGCTAGFGTCGTAGCATCATG

Wait... go back a few...

Now there's a rogue.

*snip*

GTCGTAGCATCATGCAGTAGCTAGCTAGCTAGCTAGCATGCATTAGCGCGATATCGATG
ATGCATGCATCGTACGACGTAGCTGACTGATCGATGCTAGCTATATTACGGCACGCGAT

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 2:03 PM

CALLMESERENITY


OOC: ROFL!!!!

Serenity,
President of The Juggled Gosling Chatroom
Bride8

http://callmeserenity.livejournal.com/

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 2:04 PM

COZEN


I miss the simpler days. Hammocks, wine, womenfolk staring up kilts, men dressed as women. Sigh.

*Cowers in a corner, sipping on Oban, utterly fearful of SW's blue box.*

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 3:35 PM

THEREALME


A woman walked along the rooftops of the town, lightly hopping from one to the other as if she weighed less than a feather. She was very tall and very thin, almost a caricature of a normal human being. Everything about her was white: the simple gown which clung to her body, her short spiky hair, her skin, even her fingernails and toenails. The only color anywhere on her was in her eyes, which were red and glowing. As she moved, the air chilled about her and fog formed. She expelled frost from her mouth with each breath. Spots of ice were left in the footprints of her bare feet. Krysta the Whisperer, Krysta the Ice Queen, Krysta the White, had arrived. She was quietly trailing and observing the movements of Sir Wil and 13.

Suddenly, she stopped, turned, and gazed to her left.

There was another tall, thin figure among the rooftops. A man dressed all in green floated up to her side. He held snakes in his hands, and cradled a staff in the crook of his elbow. It was Ouroborous the Green. “Greetings, lovely Krysta, my dear! And welcome!”

Krysta raised an eyebrow and cocked her head to one side. Her mouth moved almost imperceptibly.

He shook his head. “No, Sir Kei is occupied. My snakes have seen to it that our plans here will not be disturbed. I take it that you had no problem luring Sir Wil to the chicken-man? Heh! I knew that odd little creature would be useful back when I first helped it escape from Alatariel’s lab!”

Krysta’s mouth moved again, and she shrugged.

“Excellent, my dear. And I must congratulate you on those Shadow Hound replicas. Even Karg the Bloody would not be able to tell them from his very own!”

Krysta’s features grew harsh, and her mouth moved again.

“Traitors?” He grinned. “No, my dear, we are not traitors! Why, we are soon to be Heroes of the Empire! We will follow Sir Wil to find the secret lair of the Octagonal Order, destroy it utterly, and, shockingly, find one of Alatariel’s vile chicken-man spawn in their clutches! Alatariel will be the one exposed to the Empress as a traitor, or at least a fool, thanks to our careful plan. With an additional witness as truthful, honest, and pliable as Magnus the Gold, what have we to fear?”

Krysta crossed her arms and frowned. She pursed her lips, then they moved again.

“Yes, I know that Alatariel is your sister. What of it? She is in our way. My dear, it is a little late for you to get… heh… cold feet.” He laughed some more at his little joke.

Krysta’s red eyes narrowed. Her mouth moved again, more rapidly than before. She even gestured.

“Goodness! Such language!” Ouroboros chucked again. “Come, we mustn’t lose them! Are you ready to signal Magnus?”

The pair of Immortals continued to follow their prey, never noticing that they were themselves being followed by a small, floating, silvery eye.


NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 3:47 PM

THEREALME


Quote:

Originally posted by cozen:
I miss the simpler days. Hammocks, wine, womenfolk staring up kilts, men dressed as women. Sigh.

*Cowers in a corner, sipping on Oban, utterly fearful of SW's blue box.*



Sheesh, Cozen! If you feel that way, then why didn't we see more of you during the multiple threads of the Second Gala Pageant?

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 4:52 PM

THEREALME


Quote:

Originally posted by seryn:
ooc - I simply needed to warn Simonwho and all about the 'I told you so'chorus that I will be unable to stop myself from singing when the S*** hitteth the fan.



OOC - Actually, Seryn, since there was nothing much going on up on the Sereni-Tree, I decided to give SimonWho and the rest of them something to do. Besides, the list of Brides has long been incomplete. Bride1 was the first of the Brides to have any sort of personality or individuality. She was patterned after The Bride in "Kill Bill", which was out on DVD around the time the Brides first appeared.

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 9:39 PM

SIMONWHO


I'm resurrecting someone from the dead as busy work? Blimey.

GTACGTAGCTAGCTAGCTAGCTAGTCAGTGCTAGCTAGKWLEKRNWERQWERNQWER!"£$!"£$!&

Okay, this is a really bad patch.

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 22, 2006 10:32 PM

SERYN


ooc - you're missing my meaning, It's very good plot line, I'm not sure i'm liking the sound of Bride 1, but i'm sure she's lovely, and it means that Simonwho gets to type all these fantatsic genetics jokes, and it going to be bloomin interesting (which is more than i can say about my ideas for plot lines, seeing as they died a death when you all went to the pub) All in all, it's great!

But that doean't mean i won't be standing there taking great delight in saying 'I told you so!' when it all goes horribly and entertainingly wrong.

Ok?

ic -

Seryn makes her way into the centre of the village, trying to do as she said she would and follow the smell of beer, but all she can smell is frost, despite the fact that the morning chill has burned off into a clear warm sunny day.

Oh, theres goes the Spidey sense again.

she starts to hurry, still looking for a likely taverny-looking building.

http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 12:31 AM

WASHSYOUNGERSEXIERBR

Inter Arma Enim Silent Leges


Wisp found his work laborious and slow going. His team of Helpers were generous and eager to please but they required constant supervision. Wisp could only use them on basic tasks while he was intermitently doing something complicated. He had the wizard practising magic in a measuring orb hed invented to test the constructive+/destructive effects on the laws of physics and that was going well. But his tanks werent.

The physical appearance of them was done but the circuitry inside needed work. Also he had planned to run the smaller tanks by remote from the Behemoth but hadnt even started on that system.

Wisp was running back and forth directing, experimenting, and generally multi-tasking like a madman. It didnt take long for exhaustion to set in as he tripped over a loose cable he hadnt seen and was knocked unconsious on the floor. The group crowded round and eventually came up with a plan.

When Wisp awoke he felt very strange and a little separated. He wasnt quite where hewas. He spoke just as two other people spoke the same words in perfect stereo.

The wizard stepped into the fray beckoning for them to remain calm

"Wisp you have been magically cloned for 24 hours this will feel very strange at first but you must move past it"

In unison the three voices said: "TOTALLY AWESOME DUDE!!"


www.myspace.com/didxl
sexier.younger.brother@hotmail.co.uk

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 2:31 AM

THEREALME


OOC: Well, to be honest, I never particularly wanted Needleseye to eat Bride1 in the first place, though I admit that it was a surprising plot twist! So I see SimonWho as providing a public service. Otherwise, we must begin our list of Brides with Bride2!

But I see your point, Seryn, and we WILL have to explain to Bride1 how we lost her special magical katana. But all in all, there are MUCH more dangerous beings that we could bring back to life.

The FemaleReaver, for instance.

Or CallMeChucky, the Baby3000.

Hmmmm....

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 4:46 AM

SERYN


ooc - no! no no no no no! you are not bringing that horrid thing back! It freaks me out. Its worse than the dancing baby in Ally McBeal.

http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 5:41 AM

THEREALME


OOC: Hmmmm... and if I recall correctly, I handed off the broken pieces of the Baby3000 for the Yeti Hewitt to guard while I turned to deal with some other pressing crisis. That was the time of great peril, you remember. I intended to recover the pieces from Hewitt to destroy permanently, but just now it slips my mind if I ever got around to it. Seems like more peril might have surfaced, suddenly. Hewitt might still be playing with the Baby3000 bits after all this time.

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 8:42 AM

JAKE7


OOC: Well, humorous peril can be just as much fun as "real" peril...

--------------
MAL: Everybody's makin' a fuss.
***********
"They just float out there, sending out raver breeding parties..."

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 23, 2006 1:52 PM

CALLMESERENITY


*Serenity, with Sera in tow, walked into the infirmary, a tea tray in hand.*

Hello Dr. Whom! Just thought you could use a bit of a break. You've been working very hard on resurrecting Bride1.

How's that going?

And look! Freshly baked scones!

Well, enjoy! I'm off to find that husband of mine, I think he's hiding in the Security Office.

Serenity,
President of The Juggled Gosling Chatroom
Bride8

http://callmeserenity.livejournal.com/

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Sunday, September 24, 2006 10:01 AM

THEREALME


OOC:

Hi,

I've been messaged about some details of the Zanzibar situation. In short, I am afraid that I have no particular Master Plan, other than eventually releasing the Dark Harbinger, probably toward the end of this thread. Anybody can feel free to add their plot lines or characters. Oh, and I do not see the Octagonal Order's secret keep being destroyed so soon by Ouroborous and Krysta.

Let's see, there are exactly eight Immortals, listed on the previous thread. I have characterized some of them, but I do not mind at all if someone would like to take on any of the rest.

Immortals unused so far are:

Karg the Bloody (or the Red), who I pictured as a hulking male knight completely covered with armor and whose spells enhance his personal combat abilities or help him control massed armies. The biker chief Humongus of "Road Warrior" would not be a bad model for him.

Adelle the Burner (or the Orange), a regal woman slight of build but who wields terrifying fire spells with no mercy.

Zorander the Storm Caller (the Blue) who has powers of air, wind, and storm. He has a particular grudge against Sir Devan of the Octagonal Order, who attempted to kill him once.

Magnus the Maker (or the Gold), a pudgy fellow who spends all his time making fabulous magical items used by the others, and who is rather truthful and more trusting than he should be (according to Ourobouros).

Each of the Immortals has his or her own agenda, and they act together only when it suits their current plans. Backstabbing and sniping are common. Of course, they cannot be killed in any conventional way.

Also, there are, at most, eight Knights of the Octagon. You see, when they all get together they meet around this big eight-sided table. It is possible that they are not at full strength, due to recent battles. They are supposed to be powerful warriors and powerful magicians.

The Knights revealed so far are: Sir Devan, an older Obi-wan Kenobi style mentor; Sir Kei, who seems to be a brawny young man who slays monsters with ease, but who is unburdened by great intellect; and Sir Wil, who seems to be of slighter build and an expert archer. Other Knights could be introduced. Note that women Knights of the Order could certainly exist.

EDIT: As time passes, I will probably develop at least the rest of the Immortals if nobody else does. They will probably all be around for the big final conflict, whatever that may be.

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Monday, September 25, 2006 2:17 PM

WASHSYOUNGERSEXIERBR

Inter Arma Enim Silent Leges


Adelle stood on her balcony looking out over the valley. Adrianas Fortified Palace Dominated the landscape in the distance as a constant reminder of her tyrany. Adelle's robe drifted in the breeze with the layers of crimson, red, orange and yellow blurring together giving her the impression of a flaming dress. The effect was enhanced by Her deep red hair against her pale skin.

She despised the infighting of her kindred. Constantly Bickering over pointless material things like land and treasure. To an Immortal eternity was too vast to be concerned with physical matters all that mattered was passion and emotion. The bodies of the people below her withered and died but their spirit will live forever in their deeds.

She turned away from the edge and stepped inside. Her palace was a dormant volcano unlike the obsidian monstrosity's and crystal domains of her counterparts. Her doorway was a waterfall of magma which parted as she approached. The interior was a bare stone area overlooking and surrounding the magma chamber. The lid of the volcano was capped but the interior bubbled like a sun, The heat would have far surpassed a mortal beings tollerance.

A phoenix followed her inside and perched against the wall on her right. Throughout the dome many others could be seen flying iddly around.

"Hello" Her Voice was husky and empowered "What news do you bring me" The Bird flapped its wings up creating an image of sparks and fire depicting the Tree folk in the tavern, Wisp adventure with the monk and Seryns hunt for SR. It also showed Ouroborous and Krysta plotting together.


www.myspace.com/didxl
sexier.younger.brother@hotmail.co.uk

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Monday, September 25, 2006 3:38 PM

MAI


Finally awaking Mai makes her way downstairs for breakfast.

Hi everyone! What's going... EWWWWWWWWW!

*Scurries back upstairs upon seeing the snake entrails scattered through the dining area

I don't think this bodes well for the rest of the mission here. I knew I should have stayed on the ship.

*gets a really clever idea

Begins clicking the heels of her combat boots together. "There's no place like home, there's no place like home..."

*POOF!

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Monday, September 25, 2006 9:29 PM

SERYN


*arrives at the pub just in time to see Mai disappear.*

"It can't be that bad surely?"

*looks down at the spilled food, snake entrails and at the guys*

"Oh, it is that bad... Ok, girls, if there are any left *peers into the smoky gloom* I passed a great market on the way here, lets say we try some shopping - the perilesss sort - while they get cleaned up in here"



http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Tuesday, September 26, 2006 5:39 AM

WASHSYOUNGERSEXIERBR

Inter Arma Enim Silent Leges


As the sparks showed Seryn entering the Inn Adelle swung her hand threw the image scattering it across the room. The Bird obviously shocked by this flew away over the volcanos edge.

"The FOOLS!!!!" She shouted into the chasm. "They are more involved with their petty games than an actual problem"

She thrust her arm towards the lava beneath her and uttered a spell of an ancient dead language. From the fiery depths a column of magma arose carrying a staff at its peak. The staff was made of A crimson metal with a dull shine. At the tip it split into four and encircled a ball of flame burning under no fuel. The Tower reached her height and she took the staff angryly her eyes reflecting the inferno before her.

Thrusting the staff over the abyss and chanting more in her dead tounge the fire beneath her began to gurgle and spout. Flares rose to the roof of the cage raining there firey payload back into the magma chamber. Eventually three distinct shapes rose out of the red pool. They were three islands each bareing a small dragon complete with rider made of pure fire. The creatures awoke and began to roar about the chamber.

Adelle cracked her staff against the rock silencing the beasts. "There are plans afoot that must be quelled. The strangers must be occupied so the others cannot use them for their wicked ways. HOWEVER do not kill them. They may be of use"

The three dragons took off through the opening flying over her head into the valley below.


www.myspace.com/didxl
sexier.younger.brother@hotmail.co.uk

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Tuesday, September 26, 2006 6:48 AM

CALLMESERENITY


*Serenity heads up to the Security Office to find Soul sleep...working very hard.*

Hello love! *she says, kissing him.*

I need you to watch Sera for a bit. I need to do some fertilizing in my garden.

Here's her diaper bag, some toys, her blanket..oh, and Toki *she says, as the little pink bunny hops off her shoulder and curls up next to the infant.* She just ate so she should be okay for a couple of hours.

Have fun with daddy, my little dove! *She kisses them both on the forehead, gives Toki a little chin-scratch, and heads to her garden.*

Serenity,
President of The Juggled Gosling Chatroom
Bride8

http://callmeserenity.livejournal.com/

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Tuesday, September 26, 2006 4:26 PM

13


"So, who're the Immortals again?"

Wil sighed for the seventh time during the half-hour walk. This chicken-manboy was impossible.

"There's eight or so, and they're very bad, and they want us dead."

"Who's us?"

"The Knights of the Octagon!" Wil nearly screamed. He'd mentioned the name at least six times previously.

13's eyes brightened. "You mean like Chuck Liddell and Randy Coutoure and Hoyce Gracy?"

"Yes. That's exactly who I mean."

13 smiled brightly, growing anxious with the knowledge that he would meet the great Hoyce Gracy.

Wil stopped, saying rather loudly "Well, here we are. The very well hidden and secret fortress of the Octa-"

His words were interrupted by an enormous bearpaw swatting him from the ground like some easily swatted thing. Similes didn't seem to be so important at the time.

13's jaw dropped as he craned his neck to see the bear's face, which was happily drooling. 13 noticed that the drool was crawling with tiny grubs.

13 drew his sword, although he felt it would be rather useless, dashing forward, and plunged the blade into the beast's leg.

It didn't seem terribly bothered, and only payed attention when two of Wil's arrows were suddenly sprouting from it's eyes. Apparently the archer had recovered. The beast collapsed, giving rise to dust and maggoty blood.

"Yes, I realize I summoned a diseased bear, dear Krysta. I only thought that it would aid in our strategy."

That voice sounded familiar to 13 somehow. A voice of his past, which was virtually his present, and not too far behind his future.

Silence, then, "It would've caused them to be frightened of...disease...and...plague...? Yes, that's it exactly. They would run in fear of catching it." An orange robed man descended, supported by several freakishly huge herons. And one sickly looking parrot.

"They are, after all, only human." He hesitated. "Well, for the most part."


NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Wednesday, September 27, 2006 4:09 AM

THEREALME


Ouroborous the Green smiled as he began another spell. Snakes slithered up and down his arms as he did so.

Krysta the White looked this way and that. Could this REALLY be the secret door to the hidden castle of the Octagonal Order? Or had she just walked into a trap?

Below them, Sir Wil and the chicken-man called 13 stared up at them. A flicker of a smile came across Sir Wil's face...

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Wednesday, September 27, 2006 6:49 PM

SCORPIONREGENT


Quote:



"Oh, it is that bad... Ok, girls, if there are any left *peers into the smoky gloom* I passed a great market on the way here, lets say we try some shopping - the perilesss sort - while they get cleaned up in here"





SR arrives several hours later, at the pub, to discover that Seryn is infact not there.

"Hmm, she must be shopping, well I best be looking for her then, but not with this powerful thirst impairing my efficiency."

Scorpion Regent

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Wednesday, September 27, 2006 11:14 PM

SERYN


Having browsed around the pretty little knick knacks, coo-ed over the nice fabrics and raised an eyeborw at the slightly cheesy reproduction armour and weaponry, actively avoides the guy dressed in green velvet holding a bow and appraised all the corset sellers, she eventually finds what she;s looking for.

Bowing low to get through the door she finds herself in a small dingy smelly little room, and smiles broadly at the person, non-gender specific from what she can see, sitting behind a grimy counter. Chewing on something.


Less than a hour later, she's back at the inn, having given SR just enough time to sit down and look like he's been there for hours getting slowly sozzled.

Ordering herself some lunch and a glass of milk, she sit down and gives him a brief hug.

"Ok, I found what i was looking for, i now have marvellous things to help ease backpain and retaining and stop stretchmarks and soothe poor little overworked feet. Its been a productive day!

But do you still have that really bad sense of forboding?"

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 3:57 AM

THEREALME


As if on cue, a villager bursts into the inn, panic written on his face. "Dragon riders! Dragon riders are attacking the village!"

While Seryn and ScorpionRegent react to this news, in the back room Sir Kei sighs. "You'll have to excuse me for a moment," he tells his new friends TheRealMe, Jadehand, Jake7, and the rest.

As he gets up to go, TheRealMe turns to Jake7. "Huh. I wonder if these things count as chickens? Could you confuse them?"

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 5:02 AM

JAKE7


Well, if they're chickens, yes. If they're part chicken, well, it's hard to say, but I'll give it a shot.

I do have my remote with me, so everyone who wants to, stay close to me so the force field will encapsulate us all. At least we can be protected while I check to see if my confusion powers work. No sense in getting in harm's way when we don't have to!

**With that, Jake7 and the gang go outside to see what's going on. Once outside, she checks to see who's around her (OOC: I'm not naming names in case one of you doesn't feel like being in the field).**

Get in close guys!

**As the group settles in, she activates the protective force field and they all stare down the street**

Uh, TRM? What do you make of that?

--------------
MAL: Everybody's makin' a fuss.
***********
"They just float out there, sending out raver breeding parties..."

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 5:03 AM

SCORPIONREGENT


Quote:

Originally posted by TheRealMe:
As if on cue, a villager bursts into the inn, panic written on his face. "Dragon riders! Dragon riders are attacking the village!"






At this time Snarky chooses to start playing the opening bars of Mars Bringer of War by Gustav Holst. SR gently cuffs him on the back of the helmet and Snarky goes reluctantly silent.

"Well let's go see what they want to drink shall we?" says SR as he stands on slightly wobbly feet. As he advances toward the door his stride becomes more sure with every step.

Scorpion Regent

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 5:45 AM

WASHSYOUNGERSEXIERBR

Inter Arma Enim Silent Leges


The three Wisps had worked all night and had finished all of the tanks. The A.I.E was finished and gunned out the Behemoth was a rolling fortress and the smaller tanks were all wired up and ready for battle. They were all crowded round a selction of screens and blackboards discussing big words and building wierd devices. The Magical team were sat around talking and A Wisp would occasionally ask the Mage to do something magical while the others held equipment.

The group were slightly afraid of the devices as the technology was mind boggling and had always been evil. They werent at all phased by the fact that there were three of them though.

Sir Devan entered the room and was surprised at their progress over the past day. Inside he felt strange to be putting so much faith and hope into something he didnt understand. When they saw hime the three Wisps beckoned him over to theyre screens.

"You have been busy"

"We know and weve just made a big breakthrough" The Wisp in the middle said in a pace quick with excitment "We know the answer"

"To what??" Devan replied

"Magic"

Devans face was struck with a kind of horror as a strange man with a mysterious apperance could have answered a fundamental constant.

"Ok heres the thing. On this planet there is a type of wave/particle which IS magic. Its formed by the decay of a very rare isotope that is abundant in your sun."

The next Wisp took over "This Wave/particle isnt enough for people to use magic which is why I cant and other people cant"

"Its all in the genes!!" The third Wisp added quickly. With a huge grin.

"Guidan [the wizard] here and you and anyone who can use magic has an extra chromosome. This produces proteins, enzymes, chemicals, even neural structures that are affected by these magic and react accordingly. For example When Guidan creates fire he secretes 2 chemicals from his hands which react exothermically. When he levitates an object a structure in his brain harnesses the magically waves and use them to alter the physics around the object."

"Weve identified certain charicteristics in these mutations. Power, Control and Specificity. Power is the strength of the harnessing of the waves. You will have more power than Guidan and The immortals have more/= power to you. Control is very important. Some people have the correct genes for magic but they arent expressed. And some are expressed wildly. Ergo some lower level mages with treatment could become high level ones. And equally some high level ones could be reduced by chemical agents. Finally specificity is the proteins you have. For example we Guidan doesnt have the protein for somethings that the immortals do and neither have you so perhaps with a retroviral sample of their DNA we could make you have theyre powers"

Sir Devan didnt understand the words tehy used but understood the principle in their emotion that they had weapons or ideas of them. This Was what he needed to defeat the immortals.

"We have one last thing" They unveiled a long cylinder device covered in wires pipes and switches. "This device collects and re-emits magic waves over a broadband of frequencies and wavelengths. This will block the effects of all the natural magic from your sun. Your natural waves are inbuilt into the physiology of everyone on this planet. This device will kill them."

--------------------------------------

The dragon riders flew down to the valley and began to circle and swoop into the cottages and such. There were three main towns each with a collection of villages. Each dragon took an individual town and began to terrorise it. The summoning of these beasts took a lot of power and they couldnt exist outside of the lava for long, so they tried to cause maximum damage in minimum time. The Inn of the Sereni-tree-ers was in an outlying village of the central town and a dragon took extra care to burn it down when Sir kei steps outside.

OOC- do you know how long it took me to invent a scientific explanation for magic???


www.myspace.com/didxl
sexier.younger.brother@hotmail.co.uk

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 7:10 AM

SERYN


Seryn decides to remain in the inn.

Thats right, she stays put. and out of danger.

She feels she's grown as a person. Instead she watches from the dooor way, then starts marshalling the inn staff into turning the inns sturdy stone cellars into a safe spot and HQ, just incase it all goes hideously wrong. Somehow.




(ooc - but doesn't finding a scientific explaination for it kind of ruin everything? Isn;'t the great thing about magic the fact that its seemingly magical?)


http://www.myspace.com/seryndippyt

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 3:30 PM

SAFEAT2ND


Sir Kei pushes his chair back and stand up, raises his arms parallel to the floor and looks up to the roof.

Ruby’s eyes widen in dismay. “NO Kei!! Not...” She trails off as little bits of metal enter the building, making little holes, and start spinning around Sir Kei. Shortly he is obscured by the tempest. The wind eventually dies downs and Sir Kei stands dressed in his armour.

“...inside.” Ruby finishes in a small voice, surveying the damage around her.

“You know magic??” TRM asks incredulously.

“Tis but a small trick, and the only one I know. Tis handy when there is no phone booth to be found. I once again find myself apologizing for interrupting your meal. Now if you’ll please duck your head.”

A whistling sound fills the air and TRM obligingly ducks as a huge broadsword, in its scabbard, crashes through a much repaired window. Sir Kei catches it effortlessly.

“Many thanks, kind sir. Now if you’ll excuse me...” Sir Kei walks out the front door of the inn.

A large fireball catches him square in the chest throwing him backwards splintering the front door of the inn in his momentum. Sir Kei skids backward across the floor scattering tables in his wake until he comes to rest against the back wall. He sits slumped, smoke rising from his armour.

“Sir Kei?” Seryn asks.

“You know...” All are surprised when he speaks, or more that he is able to. “There are but a few things in this world worth cherishing.”

“The warm embrace of a woman,” He waggles his eyebrows suggestively at Ruby, who groans loudly and rolls her eyes “Sharing good food and drink with fine folk,” He bows grandly to his new found friends “And clean armour.”

Sir Kei storms out the front door again. The broadsword sings as it clears his scabbard. “First my good lance and now my good armour?!? Prepare to pay fell dragon!!”


__________________________________________________
"Stop doing that thing"
"What thing"
"That thing where your mouth moves and noise comes out"

NOTIFY: N   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 4:23 PM

MAI


*appears back on the ship (finally!) I mean really for magical shoes the travel time is just ridiculous.

Wonder what everyone's up to?


NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 6:03 PM

THEREALME


Quote:

Originally posted by jake7:
Well, if they're chickens, yes. If they're part chicken, well, it's hard to say, but I'll give it a shot.

I do have my remote with me, so everyone who wants to, stay close to me so the force field will encapsulate us all. At least we can be protected while I check to see if my confusion powers work. No sense in getting in harm's way when we don't have to!

**With that, Jake7 and the gang go outside to see what's going on. Once outside, she checks to see who's around her (OOC: I'm not naming names in case one of you doesn't feel like being in the field).**

Get in close guys!

**As the group settles in, she activates the protective force field and they all stare down the street**

Uh, TRM? What do you make of that?



Standing next to Jake7, TheRealMe whistles. "Lava dragons? Never heard of them. And lava riders? Weird. Look, one is coming in for a run at us. Okay, CONFUSE!"

It so happens that TheRealMe has no idea how Jake7's chicken confusing power works, if it is an aura around her or if she must activate it somehow...

The lava dragon slams directly into Jake7's force field, slumping down to the ground and shaking its head. Then it hops up and takes to the air again.

TheRealMe turns to his companion. "Jake7, did you confuse it, or did it slam into your force field because it is just stupid?"

From the inn, Sir Kei looks to have recovered his footing and is approaching again.


OOC: Whew! I'm glad that Mai has turned up on the ship again. I was thinking that we needed to start Mai-Quest 3!


TheRealMe, Captain of the Sereni-Tree

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 6:59 PM

MAI


OOC: I never said what ship I showed up on. I just wanted to play with the magical shoes. You would have thought I'd learned my lesson from the magical wish granting planks.
Also, much with the brain fry-age at the moment so I haven't decided weather I've made it home safely or not.

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Thursday, September 28, 2006 11:20 PM

SERYN


*is mightily impressed that Sir Kai managed to get up on his feet again in full armour*

"Oh!" she remebers something she bought for SR, waits fro the dragons to regroup then runs out and ties a small bag of stinky herbs around his neck "It probably won't work, but it doesn't hurt to have them anyway. " she retreats back to the inn and continues preparing the cellers.

"Ruby, i'm terribly sorry to ask this, but could we possibly smash something up, soak it threough with water and secure it on top of the trap door? it might stop them burning through quickly...."

Ruby just about manages to not, and Seryn pours her a strong gin while the barmaids start gleefully smashing some furniture to bits.

"We can pay you back for it i promise"

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Friday, September 29, 2006 9:45 AM

JAKE7


Quote:

Originally posted by TheRealMe:
TheRealMe turns to his companion.
"Jake7, did you confuse it, or did it slam into your force field because it is just stupid?"



**Jake7, wiping tears of laughter from her eyes at the spectacle of the dragon slamming into the force field, turns to TRM**

It's just that stupid! Though, it *is* hard to see this shield. These dragons must be color blind and can't see the light transparent blue of the shield.

**A lightbulb goes on over jake7's head**

Hey! I wonder if the color has to be transparent, of if just this color will make us hard to see?

What do you guys think? Is it worth a shot? If not, we still have my protective shield to use in the meantime, but I don't want to run the batteries down again like that one time!

**Meanwhile, the dragon has taken another whack to the head from trying to get past the force field and is standing up, but quite wobbly on its feet.**

Well, time to see if this thing is part chicken or not...

**jake7 takes a deep breath and begins clucking like a chicken. The wobbly dragon stares at the group and tries getting through the force field again. This time, he knocks himself out cold.**

Well, not sure if I confused it or what. But, hey, it's out cold so we should do something with him before he awakens!

--------------
MAL: Everybody's makin' a fuss.
***********
"They just float out there, sending out raver breeding parties..."

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 30, 2006 10:41 AM

MAI


Home at last!

*walks through the ship and notices everyone busy at work on the... wm whatever that is there busy at work on. looks scary.

Guess I'll go in search of something to eat. All that sleeping made me famished.

*On the wrist com: Hey Serenity! I'm home. I need baby time! Need a sitter?

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

Saturday, September 30, 2006 11:18 AM

CALLMESERENITY


MAI! Hey! Good to have you back! What's going on planetside?

I'm sure Soul would not mind being relieved of babysitting duties. He's still squeamish about changing diapers.

Did you happen to get any shoe shopping in while you were down there?

Serenity,
President of The Juggled Gosling Chatroom
Bride8

http://callmeserenity.livejournal.com/

NOTIFY: Y   |  REPLY  |  REPLY WITH QUOTE  |  TOP  |  HOME  

YOUR OPTIONS

NEW POSTS TODAY

USERPOST DATE

OTHER TOPICS

DISCUSSIONS
How much $$$ do you spend on gasoline in a month?
Fri, May 8, 2026 21:58 - 41 posts
Your favorite YouTube channels
Sun, May 3, 2026 07:10 - 123 posts
What happened to music?
Thu, April 30, 2026 08:51 - 171 posts
The Sereni-TREE: Tales For Lost Times
Wed, March 25, 2026 04:42 - 9 posts
SpaceX
Tue, March 3, 2026 14:48 - 28 posts
Anybody ever see 'Kiss Kiss, Bang Bang'?
Sun, December 28, 2025 19:31 - 17 posts
Fukushima Nuclear Reactor Status
Mon, December 22, 2025 09:24 - 133 posts
DC to Marvel - Hold my beer
Mon, December 15, 2025 07:58 - 7 posts
What others shows are you starting to get into more?
Mon, December 15, 2025 07:54 - 32 posts
What IS wrong with American TV?
Sun, December 14, 2025 18:27 - 63 posts
Good luck, Canada. You're gonna need it.
Fri, December 12, 2025 06:23 - 2 posts
Who ya gonna be this Halloween?
Fri, October 24, 2025 06:54 - 38 posts

FFF.NET SOCIAL